Selective and differential medium for isolation of Staphylococci.
| Component | Amount/L |
|---|---|
| Peptone | 10 g |
| Beef Extract | 1 g |
| Mannitol | 10 g |
| Sodium Chloride | 75 g |
| Phenol Red | 0.025 g |
| Agar | 15 g |
| pH | 7.4 ±0.2 |
The International Committee on Taxonomy of Viruses (ICTV) is the global authority responsible for the classification and nomenclature of viruses. Established in 1966, the ICTV aims to develop a universal taxonomic framework for viruses based on their evolutionary relationships, ensuring consistency in naming and classification across the scientific community.
The ICTV classifies viruses into a hierarchical structure that includes the following taxonomic ranks:
Viruses are classified based on several criteria, including:
Advances in molecular biology, particularly in genomics, have enabled more precise classification based on genetic sequencing.
The ICTV regularly updates its taxonomy to reflect new scientific discoveries. The classification system is dynamic, allowing the addition of new viral species, genera, families, and even orders as our understanding of viral diversity evolves.
The ICTV system is designed to classify all known viruses, including those that infect animals, plants, fungi, bacteria, archaea, and other organisms.
The Baltimore classification is a system proposed by Nobel laureate David Baltimore in 1971. It categorizes viruses based on their genomic structure and their replication strategy, particularly how they generate mRNA from their genomes. This system emphasizes the relationship between the viral genome and the host cell's machinery for protein synthesis.
Figure 1. The Baltimore Classification of Viruses (Image generated from Biorender.com by Admin)
| Class | Genome Type | Intermediate Step | Final Product | Examples |
|---|---|---|---|---|
| I | dsDNA | - | mRNA → Protein | Small Pox |
| II | ssDNA | ssDNA→ dsDNA | mRNA → Protein | Parvovirus |
| III | dsRNA | - | mRNA → Protein | Rotavirus |
| IV | ssRNA (+) | ssRNA (+) → ssRNA (-) | mRNA → Protein | Coronavirus |
| V | ssRNA (-) | - | mRNA → Protein | Measles |
| VI | ssRNA (+) (RT) | ssRNA (+) (RT)→ ssRNA (+) →dsRNA → dsDNA | mRNA → Protein | HIV |
| VII | dsDNA (RT) | dsDNA (RT)→ssRNA (+) →dsRNA → dsDNA | mRNA → Protein | Hepatitis B |
Viruses in this class have double-stranded DNA genomes. They utilize the host cell's DNA-dependent RNA polymerase to transcribe mRNA directly from their DNA.
Examples: Herpesviruses, Adenoviruses
These viruses have single-stranded DNA genomes. Upon entering the host cell, the ssDNA is converted into double-stranded DNA, which is then transcribed into mRNA by the host’s enzymes.
Example: Parvoviruses
Viruses in this class have double-stranded RNA genomes. The viral RNA-dependent RNA polymerase transcribes mRNA from the dsRNA genome.
Example: Reoviruses (e.g., Rotaviruses)
These viruses have RNA genomes that can serve directly as mRNA. This RNA is immediately translated into proteins by the host's ribosomes.
Examples: Poliovirus, Coronaviruses
The genomes of these viruses are complementary to mRNA. A viral RNA-dependent RNA polymerase first synthesizes a positive-sense RNA (mRNA) from the negative-sense RNA genome, which is then translated into proteins.
Examples: Influenza virus, Ebola virus
Retroviruses have positive-sense single-stranded RNA genomes. However, instead of being directly translated, their RNA is reverse-transcribed into DNA by the viral enzyme reverse transcriptase. This DNA is integrated into the host genome, where it is transcribed into mRNA.
Example: HIV
These viruses have double-stranded DNA genomes, but replicate through an RNA intermediate. The RNA is reverse-transcribed back into DNA, which is then integrated into the host genome.
Example: Hepatitis B virus (HBV)
The ICTV classification provides a detailed taxonomy based on the evolutionary relationships and structural characteristics of viruses, categorizing them into various orders, families, genera, and species. On the other hand, the Baltimore classification focuses on the replication mechanisms of viruses, categorizing them into seven distinct groups based on their pathway of mRNA synthesis. Both classification systems are complementary and often used together to provide a comprehensive understanding of viral biology.
FASTA: In the FASTA format, each sequence entry begins with a single-line description, followed by lines of sequence data. The description line typically starts with a greater-than symbol ">" followed by an identifier and optionally a description or metadata. The sequence data can span multiple lines.
FASTQ: In the FASTQ format, each sequence entry consists of four lines:
FASTA: FASTA files primarily contain sequence data and minimal metadata in the form of the description line.
FASTQ: FASTQ files contain not only sequence data but also quality scores corresponding to each base in the sequence. These quality scores are crucial for assessing the reliability of base calls generated during sequencing.
FASTA: Since FASTA files do not include quality scores, there's no inherent information about the reliability or confidence of each base in the sequence.
FASTQ: Quality scores in FASTQ files provide information about the confidence level associated with each base call. These scores are typically represented using ASCII characters and can be used to assess the accuracy of sequencing data and to filter out low-quality reads.
FASTA: FASTA format is commonly used for representing sequence databases, sequence alignments, and other sequence-related data where quality information is not required.
FASTQ: FASTQ format is specifically designed for storing data generated by sequencing platforms such as Illumina, which produce both sequence data and corresponding quality scores. It's widely used in various bioinformatics applications including read mapping, variant calling, and de novo assembly where base call accuracy is crucial.
FASTA Example:
>Sequence1 ATCGGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTA >Sequence2 CTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGC
@SEQ_ID1 GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT + !''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65 @SEQ_ID2 TTGGCAGGCCAAGGCAGGCAGGCAGGCAGGCAGGCAGGCAGGCAGGCAGGCAGGCAGGCA + CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC
Phred scores are a commonly used way to represent the quality of base calls in DNA sequencing data. They are given as logarithmic probabilities, and higher scores correspond to greater levels of confidence in the base call's accuracy.
The formula to convert a Phred score (Q) to a probability (P) is:
P = 10^-Q/10
Q = -10 x log10(P)
Peptidoglycan Structure:
Initiation of Peptidoglycan Synthesis:
Translocation of Lipid II to the Cell Wall:
Glycan Chain Elongation:
Cross-Linking of Peptide Chains:
Remodeling and Turnover:
Overall, the synthesis of the bacterial cell wall is a highly coordinated and dynamic process involving the sequential assembly of peptidoglycan components, translocation across the membrane, and cross-linking of peptide chains. Disruption of cell wall synthesis is a target for antibiotics such as beta-lactams, which inhibit transpeptidase activity and prevent cross-linking, leading to bacterial cell death.
Initiation:
Elongation:
Termination:
Post-translational Modifications:
Regulation:
Overall, translation is a complex and highly regulated process that plays a central role in gene expression and protein synthesis. It allows cells to convert the genetic information stored in mRNA into functional proteins essential for cellular structure, function, and regulation.